Aller au contenu
forum sidasante
Schnappi

**[SIDA] : le "VIH" ne cause pas le SIDA ** 3/3

Recommended Posts

Invité dartagnan32

Re prenons le texte des materiels et methods:

« Experiments were performed under serum-free conditions in AIM V medium (Life Technologies Inc.) for activated lymphocytes and RPMI 1640 medium (Sigma) for macrophages. Cells were treated for 1 h at 37°C with 5 to 20 µM LY294002 (Sigma), 100 nM wortmannin (Sigma), 50 µM benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone (z-VAD-FMK) (Calbiochem) or dimethyl sulfoxide (DMSO) control prior to infection with HIV-pseudotyped luciferase reporter virus. Unless otherwise noted, inhibitors were present during the entire infection. Triplicates of 7 x 104 CD4+ T cells were infected with 7.25 ng of reverse transcriptase from HIV-1 HXB2- or JRFL-pseudotyped virus at 37°C. Triplicates of 3 x 105 macrophages were infected with 0.28 ng of reverse transcriptase of JRFL-pseudotyped virus (with Vpr) at 37°C. Cells were lysed 24 h postinfection, and luciferase expression was measured with the Promega (Madison, Wis.) luciferase assay system. Units were normalized relative to total protein concentration for each sample.”

Les experiences sont faites dans du milieu AIMV. Donc tout est bien mis en culture. Elles sont traitees d’abord 1h avec les differents inhibiteurs ou lorsqu’ il n’y a pas d’inhibiteur on met du dmso (dans lequel sont dilues ces inhibiteurs) de facon a avoir vraiment le meme milieu. Ensuite ils font des triplicates c'est-à-dire trois puits avec traitement identique pour chaque point avec l’un ou l’autre des virus ou avec rien. Les cellules sont lysees 24h apres infection.

Donc c’est bien identique. Nous savons tous comment faire des experiences et on fait toujours les controles ainsi… Je fais pareil et j’obteins la meme chose. Les experiences sont repettees maintes fois… Cette publi est bien peer-reviewed comme vous aimez bien l’entendre dire… Ou alors peer-reviewed ne sert a rien puisque les controles ne sont jamais bons ? Il est bien connu que les 2 ou 3 scientifiques qui soutiennent votre these et le perth group ou meme vous-même etes les seuls a voir que les controles sont bons donc seules les publis peer-reviewed que vous montrez sont bonnes… Tout de meme ce contrôle particulier est toujours le meme et on n’y detecte rien. Mais bon les chercheurs sont tous ou presque mauvais et font toujours de mauvais controles …

Une autre publi : http://www.jimmunol.org/cgi/content/full/175/6/3990 figure 4 de nouveau les cellules sont forcement en culture dans les memes conditions que les autres et on ne detecte rien sans infection (RV, retroviral vector)…

Pour Cheminot,

Encore une fois la sequence complete du genome humain a ete sequencee. Y compris le junk DNA. Donc meme si on ne connaît pas encore tous les ARN qui en resultent, toute la sequence est la et rien…

Exemple : prenons cette sequence presente dans la publi ci-dessus : GGCTAACTAGGGAACCCACTG

Va dans cette page qui cherche des similarites dans le genome entier : http://www.ncbi.nlm.nih.gov/genome/seq/Bla....cgi?taxid=9606

Et il ne trouve rien d’approchant et pourtant ce ne sont que 21 nucleotides sur les millions presents dans le genome du VIH et dans une region des plus equivalente d’un retrovirus a l’autre vu que c’est dans le LTR… (regions repetees de chaque cote des genomes des retrovirus ou retrotransposons)

Par ailleurs tu parles des proteines nommees a partir de HTLV-1 qui est « tres » proche du VIH. Il y a cependant pas mal de differences presentes pour les proteines analogues (et HTLV-1 est bien exogene au fait, encore une fois pas d’homologie avec ce qu’on retrouve dans le genome humain). Mais que faire de Vif, Vpr, Vpu, Nef qui n’existent que dans le VIH et pas ailleurs (pas meme dans le « tres proche » HTLV…) elles viennent d’où ces proteines ?

Enfin que penser de SIV (smm) par exemple, ce virus infecte et rend malade les macaques, ils ont l’equivalent du SIDA. On en parle la par exemplehttp://www.jimmunol.org/cgi/content/full/179/5/3035

On comprends bien en lisant l’introduction. Donc ces singes lorsqu’ils sont infectes par le SIV developpent la meme deficience que les humains infectes par le VIH. Et pourtant ils n’utilisent pas de Poppers ! (non la je rigole pardon) Et leur localisation n’est pas mutuellement exclusive avec celle des autres singes… Au cas ou vous voudriez invoquer les nitrates utilises dans l’agriculture qui toucheraient comme par hasard certains singes…. De plus ces macaques ont ete maintes fois infectes en laboratoire par le seul virus soit en intraveineux soit par voie mucosale… Et ils developpent des maladies… ( enfin je suis pas specialement enthousiaste avec l’experimentation animale et les faire souffrir les pauvres)

La difference d’induction de maladie entre les differents types de singes peut etre due a Nef d’apres certaines etudes. Un SIV sans nef peut se repliquer mais n’induit pas de maladie. En fait certaines mutations dans nef pourraient expliquer l’absence de developpement de la maladie. En fait ces virus sont apparus plus recemment dans ces singes comme chez nous donc l’equilibre pathogene/hote n’a pas ete atteint…

En conclusion, je pense que de toute facon je ne vous convaincrais jamais et vous ne me convaincrez jamais, tout du moins avec les connaissances actuelles, et malheureusement mon travail est tres prenant. Donc travaillons chacun de notre cote (de mon cote je continuerai a faire des experiences sans contrôle icon_wink.gif ) et essayons de faire avancer les choses de prouver des choses ou de trouver des therapies, peut etre un jour l’un des deux cotes prouvera incontestablement son fait. Notre but a tous est d’esperer trouver quelquechose qui puisse guerir tous ces malades. Esperons que ceci arrivera sous peu.

Partager ce message


Lien à poster
Partager sur d’autres sites

Parce qu'autrement, je pense que Foley sur bmj n'est pas exactement loin de la vérité quand il dit:

No virus has ever been isolated and characterized by the exact methods or techniques that the Perth group is claiming to be required for proof of the existence of HIV.

Il ne s'agit pas de la méthode du Perth Group mais bien celle des meilleurs rétrovirologues de l'époque. C'est d'ailleurs tellement vrai qu'il s'agit de la méthode (à tort attribuée au Perth Group) qui a été utilisée par les deux "découvreurs" du "VIH", à savoir Montagnier en 1983 et Gallo en 1984, et c'est justement en vertu de cette méthode qu'ils ont prétendu avoir isolé un nouveau rétrovirus "VIH". Si cette méthode n'était pas efficiente et probante, pourquoi Montagnier et Gallo l'ont-ils utilisé (ou plutôt : "prétendu l'avoir utilisée") ? Et pourquoi se sont-ils fondés justement sur cette méthode-là pour prétendre avoir isolé un nouveau rétrovirus "VIH" ?

Ceci étant, l'analyse de leurs publications permet de constater qu'ils n'ont en fait pas utilisé comme il fallait cette méthode avancée par les rétrovirologues eux-mêmes puisque (et entre autres multiples autres défauts), ils n'ont jamais publié la photographie au microscope électronique du matériel récolté dans le gradient de densité où sédimentent par définition les rétrovirus. En 1997, Montagnier fit lui-même l'aveu que même après un "effort de romain", il n'avait jamais pu voir la moindre particule d'apparence rétrovirale dans ce gradient de densité. Dès lors qu'il n'y pas de telles particules, il ne saurait y avoir par définition de rétrovirus. En d'autres termes, pas de "VIH", pas d'hypothèse rétrovirale. Et si on ne voit pas dans ce gradient de densité une particule d'apparence rétrovirale (je ne les appelle pas encore "rétrovirus" car il faut encore et au moins prouver qu'elles se répliquent), il n'y a évidemment pas d'antigènes de "VIH" et pas d'ARN de "VIH", et donc pas de tests "VIH" ou de charge "virale" possible.

Et je rappelle encore ceci : "Les rétrovirus ne relèvent pas de notions cosmologiques, nucléaires ou ésotériques dont l'existence supposée ne pourrait être qu'inférée à partir d'observations indirectes. Ce sont des particules que l'on peut voir, même si ce n'est pas à l'œil nu."

Donc, pas de particules d'apparence rétrovirale dans le gradient de densité où sédimentent par définition les rétrovirus, pas de "VIH". Et pas de théorie infectieuse du "sida".

Bon, moi, je suis maintenant parti pour tout le week-end. Suis déjà fort en retard.

Partager ce message


Lien à poster
Partager sur d’autres sites

Re prenons le texte des materiels et methods:

« Experiments were performed under serum-free conditions in AIM V medium (Life Technologies Inc.) for activated lymphocytes and RPMI 1640 medium (Sigma) for macrophages. Cells were treated for 1 h at 37°C with 5 to 20 µM LY294002 (Sigma), 100 nM wortmannin (Sigma), 50 µM benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone (z-VAD-FMK) (Calbiochem) or dimethyl sulfoxide (DMSO) control prior to infection with HIV-pseudotyped luciferase reporter virus. Unless otherwise noted, inhibitors were present during the entire infection. Triplicates of 7 x 104 CD4+ T cells were infected with 7.25 ng of reverse transcriptase from HIV-1 HXB2- or JRFL-pseudotyped virus at 37°C. Triplicates of 3 x 105 macrophages were infected with 0.28 ng of reverse transcriptase of JRFL-pseudotyped virus (with Vpr) at 37°C. Cells were lysed 24 h postinfection, and luciferase expression was measured with the Promega (Madison, Wis.) luciferase assay system. Units were normalized relative to total protein concentration for each sample.”

Les experiences sont faites dans du milieu AIMV. Donc tout est bien mis en culture. Elles sont traitees d’abord 1h avec les differents inhibiteurs ou lorsqu’ il n’y a pas d’inhibiteur on met du dmso (dans lequel sont dilues ces inhibiteurs) de facon a avoir vraiment le meme milieu. Ensuite ils font des triplicates c'est-à-dire trois puits avec traitement identique pour chaque point avec l’un ou l’autre des virus ou avec rien. Les cellules sont lysees 24h apres infection.

Donc c’est bien identique.

Ben, je suis désolé, mais il n'y a rien de précisé pour le troisième triplicate. Donc, qu'est-ce qu'il y a dedans ? On ne sait pas. Dans la mesure où ils testent un inhibiteur de PI3-kinase, peut-être que le troisième puit est un truc infecté, mais traité avec la PI3-kinase. Donc, considéré comme non infecté. Ce n'est pas clair du tout.

Et puis, même en supposant que ça soit bien une culture non infectée, sur la figure 6, on ne voit pas ce que donne la PCR sur le uninfected. On a bien le résultat en B dans un graphique. Mais on n'a pas la fluorescence, comme pour les autres triplicates. Donc, sans le résultat visuel de la PCR, on doit leur faire confiance. Ce n'est pas acceptable.

Surtout que la PCR ne donne pas beaucoup de copies (1000). Entre 1000 et rien, avec la PCR, la frontière est mince. Donc, il suffit qu'il y ait eu une légère variation pour qu'on se retrouve avec rien, ou un truc considéré comme rien.

Sinon, comme le dit Nicholas Bennett, cité par Wallypat, les expériences ne sont pas faites en aveugle. C'est vrai que c'est un énorme défaut du truc. Vu la capacité des virologues à truander leurs expériences concernant la culture de controle (cf. les expériences citées par Wallypat), l'expérience en aveugle me semble indispensable.

Sinon, pour ce que tu dis à la fin "peut etre un jour l’un des deux cotes prouvera incontestablement son fait.", pour nous, c'est bon. On peut faire faire redevenir négatif un séropositif très facilement. Je pense avoir trouvé ce que sont les trithérapies (en fait, des corthicothérapies) et donc, j'ai trouvé comment faire arrêter aux séropositifs leur traitement sans qu'ils subissent d'effets secondaires (les mêmes qu'à l'arrêt d'une corticothérapie). Du coup, on peut faire varier la charge virale et le taux de cd4 facilement. Comme déjà dit, on trouve la p24, la gp120, la gp47 et la p31 chez 40 % des chiens testés. Il y a des gens qui ont une charge virale positive jusque à environ 10.000 copies et qui sont négatifs aux tests d'anticorps. De notre coté, la messe est dite.

Partager ce message


Lien à poster
Partager sur d’autres sites

Bonjour,

après un week-end sans (ordinateur), je rejoins le forum et constate que D'artagnan refuse d'aller plus loin dans le débat. Serait-ce que ses arguments manquent de force et de références convaincantes?

Je reprends ce qu'il a dit dans son dernier post.

En ce qui concerne l'existence dans le génome humain de la chaîne de nucléotides qu'il décrit, je dirai d'abord que les avis officiel sont encore partagés sur le fait de connaître parfaitement le génome humain. Ensuite, il y aurait de plus en plus de preuves qu'on retrouve des séquences dites virales dans ce génome .

Enfin, et là je touche à un dogme des biologistes, la réactivité chimique des cycles puriques et pyrimidiques vis-à-vis des oxydants n'est pas identique. La position de la base dans la chaîne engendre également de manière indubitable une régiosélectivité à longue distance.

On ne peut donc pas prétendre, comme le fait ce dogme, édicté par Monod, que l'attaque des bases par un agent (le plus souvent oxydant, puisque les cycles sont riches en électrons) soit aléatoire.

On sait par exemple que les guanosines sont bien plus sensibles (en 8 ) que les autres bases. Et comme ces bases, situées sur la face interne de l'un des brins de l'hélice, sont de plus parallèles les unes aux autres, il y a obligatoirement interaction électronique entre elles.

Donc chaque type d'oxydant aura un impact particulier. Les ions superoxyde ne sont par exemple pas nitrants, contrairement aux peroxynitrites. C'est ce caractère nitrant qui est à la base de la modification non aléatoire des bases, et donc de leur transformation par la rétrotranscriptase (qui n'est qu'une polymérase) en un ADN anormal. Il suffit d'introduire n'importe quel ADN anormal, de plus commençant par un polyA, dans une cellule, pour qu'elle fasse apparaître l'ARN correspondant, puis la protéine mutée correspondante.

Mon hypothèse sur l'ARN et les protéines dites du VIH, à savoir que celles-ci feraient partie d'un processus naturel de contrôle de la prolifération cellulaire, cet ARN et ces protéines, dont la formation résiderait en l'oxydation régiosélective d'une partie du génome par les peroxynitrites, présuppose également que la structure en question est stable a priori, puisque obtenue depuis des millions d'années par ce processus.

Le problème est que vous ne vous rendez pas compte que vos tests, et je le répète en l'assénant, sont des tests à limite, et vos dires prouvent bien que vous ne comprenez pas ce que cela signifie. L'homme des cavernes, l'homme du 19ème siècle n'étaient pas soumis à l'action de ces donneurs de NO exogènes, mais pourtant, leurs cellules portaient déjà, en quantité infinitésimale, cet ARN, ces protéines (P24), qui, nous ne pouvons qu'être désolés pour vous) sont spécifiques du phénomène de nitration par les peroxynitrites, et non pas d'un prétendu virus exogène qu'on a défini simplement parce que c'est la mode aux virus.

Et quand ce phénomène de nitration s'exacerbe par l'apport de donneurs de NO exogènes, le phénomène s'emballe et deux phénomènes apparaissent, de manière parallèle et non consécutive :

- l'augmentation de nos chers marqueurs

- la disparition des lymphocytes et donc l'immunodéficience.

Partager ce message


Lien à poster
Partager sur d’autres sites
Invité glaiveque

Parce qu'autrement, je pense que Foley sur bmj n'est pas exactement loin de la vérité quand il dit:

EPE:(...) The existence of HIV was not established by Montagnier and Gallo -- or anyone since -- using the method presented at the 1973 meeting.

CJ: And what was that method?

EPE: All the steps I have just told you. The only scientific method that exists. Culture cells, find a particle, isolate the particle, take it to pieces, find out what's inside, and then prove those particles are able to make more of the same with the same constituents when they're added to a culture of uninfected cells.

Alors, culture ou pas culture icon_confus.gif

Partager ce message


Lien à poster
Partager sur d’autres sites

Alors, culture ou pas culture icon_confus.gif

Oui, effectivement, l'analyse des écrits du Perth Group permet de constater qu'ils n'ont jamais demandé à ce que l'on tente de détecter du "VIH" directement à partir du plasma d'un sidéen et ont depuis toujours demandé à ce qu'on suive la méthode traditionnelle suivie par les plus grands rétrovirologues, soit celle fondée sur la culture.

Ceci étant, au cours du débat qui a opposé récemment et pendant plus de deux ans orthodoxie et dissidence du sida, le Perth Group, et à ma connaissance pour la première fois, s'est interrogé sur le point de savoir pourquoi on ne trouvait pas de "VIH" directement à partir du plasma des patients, citant à cet égard les meilleurs rétrovirologues, dont entre autres Hans Gelderblom lui-même.

Visiblement, l'argument a malgré tout ému l'orthodoxie du sida puisque Christopher Noble a contacté ensuite personnellement Hans Gelderblom à ce sujet, comme expliqué ici :

Les souris atteintes de la leucémie de Friend ont un nombre considérable de particules rétrovirales dans leur sang circulant. Ce phénomène, que l’on appelait « Virémie » dans le passé (1), serait appelé « Charge Virale » dans le language d’aujourd’hui. A partir de quelques centimètres cube de plasma sanguin de ces souris, les particules virales étaient facilement isolées, par une simple méthode d’ultrafiltration et de centrifugation. Préparées ensuite pour la microscopie électronique, les résultats étaient illustrés comme suit :

.......

Ce qui est proprement stupéfiant, c’est que personne n’a réussi jusqu’ici , en appliquant cette méthode simple, à démontrer les particules de VIH dans le sang d’aucun malade dit atteint du SIDA, même si les échantillons sanguins sont prélevés chez des patients identifiés, par les méthodes de la PCR, comme ayant une « Charge Virale » élevée ! L’absence de toute donnée en microscopie électronique permettant d’élucider la nature de la dite « Charge Virale » chez les patients sidéens, si embrarassante qu’elle soit, a été soulignée pour une première fois lors d’une importante conférence sur le SIDA, à Prétoria, en mai 2000 (2). Aucun des experts présents à cette conférence n’a pu démontrer, ou faire référence à des publications dans lesquelles le VIH aurait été observé directement dans le sang de malades sidéens. Par surcroît, il y aura bientôt deux ans qu’une prime de 100.000 dollars a été officiellement offerte (3) à celui qui réussirait à démontrer les particules de VIH dans le sang de malades supposés avoir une charge virale élevée. A ce jour, cette prime n’a jamais été réclamée. Manifestement, l’isolement et la purification de particules rétrovirales que l’on pouvait si facilement effectuer chez les souris leucémiques n’ont jamais pu être réalisés chez les patients du SIDA.

Mais contrairement à Etienne de Harven, le Perth Group se montre extrêmement conciliant à l'égard de l'orthodoxie du sida en ne recourant pas à la méthode d'Etienne de Harven, se satisfaisant (je ne pense vraiment pas que le Perth Group soit exigeant en la matière) de la méthode basée sur la culture, soit la méthode préconisée par l'Institut Pasteur en 1973, lors d'un symposium qui avait réuni plusieurs des meilleurs rétrovirologues de l'époque, et ne peut donc que s'étonner que l'on ai jamais pu voir de "VIH" selon cette méthode, préconisée par les rétrovirologues eux-mêmes. L'ensemble des innombrables autres failles de l'hypothèse rétrovirales soulignées par le Perth Group (et bien d'autres scientifiques dissidents, ainsi que par un nombre toujours plus croissant de chimistes [cf cette liste de dissidents ayant eu le courage de se faire connaître]), ne font que confirmer surabondamment ce "détail".

Partager ce message


Lien à poster
Partager sur d’autres sites

Au sujet du mythe de la transmission sexuelle de la séropositivité.

Lisez ce petit article anglais qui vient de paraître, où l'on constate que dans le comté de San Diego (USA), le nombre de MST autres que l'hypothétique "VIH" (syphilis, chlamydia, gonorrhée, ...) a augmenté de 800% (!), soit huit fois plus, de 1997 à 2006, 80% de ces cas se retrouvant chez les homosexuels.

On s'attendrait logiquement à ce qu'en application de l'hypothèse rétrovirale du "sida"", le (supposé) taux de transmission de l'(hypothétique) "VIH" ait augmenté aussi de façon aussi exponentielle durant cette même période, dans ce même comté, chez ces mêmes homosexuels.

Mais qu'en est-il réellement ?

Et bien, allez à la page 11 de cette étude de 2006, examiner le graphique du milieu ... et vous constaterez que chez ces mêmes homosexuels, le taux de (supposé) infection par le "VIH" a diminué (!) sur la même période (du moins, jusqu'en 2005, date où s'arrête l'étude), dans ce même comté de San Diego (de 6% en 1997 à 4% en 2005 des tests "VIH" pratiqués sur des homosexuels sont positifs à l'hypothétique "VIH"), soit une diminution de 33% !

Donc, augmentation de 800% des vraies MST et sur la même période, diminution de 33% du "VIH" chez les mêmes gay (soit une différence de comportement de 2.400% [800% x 3]) ! La protection conférée par les préservatifs contre les MST serait donc à géométrie (très) variable et même tout simplement opposée en fonction des (vraies et pseudo) MST !

Partager ce message


Lien à poster
Partager sur d’autres sites

Et sur le forum AidsMythExposed, on a un autre cas de séroréversion. Ici

Partager ce message


Lien à poster
Partager sur d’autres sites

Une dépêche anglaise intéressante du 4 octobre 2007, révélant qu'il existe un nombre fort élevé de bébés et d'enfants séropositifs ... alors que leurs mères respectives ne le sont pas !

Evidemment, pour faire tenir l'hypothèse rétrovirale du sida, il est alors déclaré par les "experts" ès "VIH" que les enfants en question ont été "contaminés" par le "VIH" (pourtant considéré comme un rétrovirus extrêmement délicat et fragile, à ce point délicat d'ailleurs qu'il est - "bizarrement" - détruit [voilà qui est bien commode pour l'orthodoxie du sida !] lorsqu'on tente de le voir chez le moindre sidéen, même ayant une charge dite "virale" astronomique ) lors de leur passage à l'hôpital !

En revanche, si l'on considère, comme nous, la séropositivité comme étant un phénomène découlant d'un déséquilibre oxydo-réducteur et pouvant être passager (cf les cas de séroréversion), il n'est nul besoin de se creuser les méninges pour l'expliquer, comme le fait l'orthodoxie du sida, trop soucieuse de devoir respecter un dogme coûte que coûte. 5-tss.gif

Partager ce message


Lien à poster
Partager sur d’autres sites

Effectivement, c'est de mieux en mieux. Enfin, dans le sens ou c'est dit par l'orthodoxie.

Evidemment, nous, on savait bien qu'avec des antibiotiques ou des vaccinations, un bébé peut éventuellement réagir positif, même si la mère est séronégative.

Partager ce message


Lien à poster
Partager sur d’autres sites

De mieux en mieux!

http://www.independent.co.uk/life-style/he...its-842478.html

Threat of world Aids pandemic among heterosexuals is over, report admits

Alors, ce préservatif, ces incarcérations, c'est du pipeau?

Partager ce message


Lien à poster
Partager sur d’autres sites

Et les news indiennes en rajoutent!

Partager ce message


Lien à poster
Partager sur d’autres sites

Une dépêche anglaise intéressante du 4 octobre 2007, révélant qu'il existe un nombre fort élevé de bébés et d'enfants séropositifs ... alors que leurs mères respectives ne le sont pas !

Merci Wallypat et Cheminot pour ces liens très intéressants.

Concernant l'article sur les enfants, on peut préciser que l'article a été écrit par David Gisselquist, qui a notamment suggéré à l'issue d'une vaste étude en Afrique que l'utilisation d'un matériel médical insuffisamment stérilisé (notamment les seringues utilisées plusieurs fois faute de moyens) pourrait être à l'origine des forts taux de séropositivité au test dit VIH en Afrique subsaharienne. Il occupe ainsi une place intermédiaire, car sans remettre en cause le VIH, il en dévoile certaines incohérences et remet timidement en cause certaines hypothèses de l'orthodoxie, en premier lieu la transmission sexuelle du VIH.

Un point important qui explique peut-être ces prises de positions plus courageuses que la moyenne : David Gisselquist n'est pas médecin.

Partager ce message


Lien à poster
Partager sur d’autres sites

La consécration du summum de la bêtise scientifique

Montagnier reçoit en 2008 le prix Nobel de médecine pour avoir "découvert" le prétendu rétrovirus "HIV" en 1983.

Il est certain que le comité attribuant les prix Nobel n'ont jamais lu les écrits du Perth Group, qui n'ont jamais pu être réfutés (en tout cas pas pour ce qui concerne la prétendue isolation du "VIH") jusqu'à ce jour dans ne fût-ce qu'un seul article scientifique publié dans une revue scientifique peer review.

On rappellera qu'en 1983, Montagnier n'a jamais découvert et encore moins isolé un nouveau rétrovirus "VIH" mais bien uniquement découvert l'apparition de marqueurs dans une culture qui ont été interprétés comme étant le signe d'une infection rétrovirale par un nouveau rétrovirus.

La preuve n'a pourtant jamais été faite à ce jour que ces marqueurs étaient spécifiques d'un rétrovirus, et encore moins d'un nouveau rétrovirus.

Pour plus d'infos sur la prétendue découverte du "VIH" par Montagnier en 1983, lisez cette critique dévastatrice faite par le Perth Group.

Partager ce message


Lien à poster
Partager sur d’autres sites

Cette critique là je ne l'avais pas encore lue. Merci. Une fois de plus on se demande comment c'est possible que des arguments aussi tâtonneurs puissent servir d'assise pour la construction hiv/sida. Pas étonnant que ce soit un château de cartes et que tout souffle dissident soit maudit, car ça peut s'écrouler au moindre courant d'air frais.

J'ai quand-même du mal à croire que Montagnier se sente à l'aise avec une telle critique.

En plus de tous les problèmes concrèts de santé etc., il y là un problème de valorisation d'information, de la valeur accordée à l'écrit (scientifique), de l'écrit scientifique qui devient vérité absolue, quasi sacrée. Sur quoi se greffe le relais de la presse, la télé-icône sacrée et surtout les (intérêts) politiques. En gros, moins la théorie de base est clair, plus il y a de la marge pour récuperer une telle théorie à son propre profit, même si on peut penser que c'est souvent dans une bonne intention. Mais tout ça on le savait déjà.

brume

Partager ce message


Lien à poster
Partager sur d’autres sites

Bonjour,

Je serai moins pessimiste que toi, Wallypat, tout simplement parce que le personnage principal de cette farce, Bob Gallo, ne figure pas parmi les Nobel.

C'est pour moi un signe que de mettre en avant celui, qui, tout en essayant de conserver une voix d'autorité dans le concert des "scientifiques", a osé à plusieurs reprises avancer l'idée que d'autres causes seraient à l'origine du Sida : mycoplasme, et, plus récemment, le stress oxydatif.

voir aussi cet interview

Il aura maintenant les coudées plus franches pour avancer ses pions, et je persiste à penser, comme Etienne de Harven, que nous sommes à un tournant, avec la démission de Peter Piot de l'Onusida, la sortie de Kevin De Cock qui déclare que le Sida hétérosexuel n'existe plus, et bien d'autres signes ténus, comme la décroissance des cas estimés de 40 Mions à 33 Mions en un an.

Bob Gallo est celui qui a imposé l'idée que le VIH est la cause "probable" du Sida, et qui a déclenché l'hystérie qu'on connaît.

On doit pleurer dans les chaumières américaines!! Lol!

Partager ce message


Lien à poster
Partager sur d’autres sites

Mouai. On peut voir aussi la chose comme étant une sorte de lot de consolation pour Montagnier. Gallo a pu se faire un fric phénoménal avec le brevet de son test VIH et Montagnier, a priori, n'a rien eu. Et là, les quelques centaines de milliers d'euros du prix nobel, ainsi que l'honneur qui y est attaché, seraient comme une petite compensation pour Montagnier.

Partager ce message


Lien à poster
Partager sur d’autres sites

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.

Invité
Répondre à ce sujet…

×   Vous avez collé du contenu avec mise en forme.   Supprimer la mise en forme

  Only 75 emoji are allowed.

×   Votre lien a été automatiquement intégré.   Afficher plutôt comme un lien

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.

Chargement

×
×
  • Créer...